Journal: Nature Communications

Article Title: Exosome engineering for efficient intracellular delivery of soluble proteins using optically reversible protein–protein interaction module

doi: 10.1038/ncomms12277

Figure Lengend Snippet: ( a ) Schematics of DNA constructs used for the production of EXPLOR. ( b ) Schematic showing fusion proteins and their proposed action. ( c ) HEK293T cells were transiently transfected with CIBN-EGFP-CD9 and mCherry-CRY2 expression vectors. The mCherry fluorescence was imaged before and after 488-nm laser stimulation (15 s in duration, 350 μW cm −2 ). Scale bars, 20 μm (5 μm for inset images). A representative result from at least 10 experiments. ( d ) HEK293T cells transiently transfected with CIBN-EGFP-CD9 and mCherry-CRY2 were imaged for time-lapse imaging of mCherry fluorescence for varying time periods (0–12 min) after a stimulation (black arrow) of 488-nm light (15 s in duration, 350 μW cm −2 ). Scale bars, 5 μm. A representative result of at least 10 experiments. ( e ) Quantification of mCherry fluorescence in the cytoplasm and at the plasma membrane. Data are presented as the mean±s.e.m. ( n =3).

Article Snippet: Primary antibody sources were as follows: mouse monoclonal mCherry antibody (diluted 1:1,000 for western blotting, 1:50 for EM, ab125096), rabbit monoclonal CD9 antibody (diluted 1:50 for EM, ab92726) and NF-κB antibodies (diluted 1:1,000 for immunocytochemistry, ab16502) were obtained from Abcam (Cambridge, MA, USA); CD63 (diluted 1:1,000 for western blotting, sc-15363) and GAPDH (diluted 1:4,000 for western blotting, sc-25778) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); cytochrome c antibody (diluted 1:1,000 for immunocytochemistry, 556432) was from BD biosciences (San Jose, CA, USA); and the GFP antibody (diluted 1:1,000 for western blotting, 2555) was from Cell Signaling Technology (Beverly, MA, USA).

Techniques: Construct, Transfection, Expressing, Fluorescence, Imaging, Clinical Proteomics, Membrane

Journal: Nature Communications

Article Title: Exosome engineering for efficient intracellular delivery of soluble proteins using optically reversible protein–protein interaction module

doi: 10.1038/ncomms12277

Figure Lengend Snippet: ( a ) Cells transiently transfected with CIBN-EGFP-CD9 and mCherry-CRY2 expression vectors were maintained under blue light illumination of varying powers for 48 h. Cell-derived exosomes were subject to immunoblot analysis using antibodies against mCherry, EGFP and CD63, an exosome marker. A representative result from three independent experiments. ( b ) The graph presents densitometry analysis for normalized amount of mCherry-CRY2 protein over CIBN-EGFP-CD9 protein from three independent experiments. Data are presented as the mean±s.e.m. ( n =3), and Tukey's post hoc test was applied to significant group effects (** P <0.01, *** P <0.001) identified by analysis of variance.

Article Snippet: Primary antibody sources were as follows: mouse monoclonal mCherry antibody (diluted 1:1,000 for western blotting, 1:50 for EM, ab125096), rabbit monoclonal CD9 antibody (diluted 1:50 for EM, ab92726) and NF-κB antibodies (diluted 1:1,000 for immunocytochemistry, ab16502) were obtained from Abcam (Cambridge, MA, USA); CD63 (diluted 1:1,000 for western blotting, sc-15363) and GAPDH (diluted 1:4,000 for western blotting, sc-25778) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); cytochrome c antibody (diluted 1:1,000 for immunocytochemistry, 556432) was from BD biosciences (San Jose, CA, USA); and the GFP antibody (diluted 1:1,000 for western blotting, 2555) was from Cell Signaling Technology (Beverly, MA, USA).

Techniques: Transfection, Expressing, Derivative Assay, Western Blot, Marker

Journal: Nature Communications

Article Title: Exosome engineering for efficient intracellular delivery of soluble proteins using optically reversible protein–protein interaction module

doi: 10.1038/ncomms12277

Figure Lengend Snippet: ( a ) HEK293T cells were transiently transfected with luciferase-mCherry-CRY2 expression vector alone, XPack-luciferase-mCherry expression vector or co-transfected with CIBN-EGFP-CD9 and luciferase-mCherry-CRY2 expression vectors. After 24 h, cells were imaged by fluorescence microscopy for the expression profile of mCherry fusion proteins. A representative result from five independent experiments. Scale bars, 20 μm. ( b ) Quantification of mCherry fluorescence. Data are presented as the mean±s.e.m. ( n =5), and Tukey's post hoc test was applied to significant group effects identified by analysis of variance (ANOVA). Control: untransfected HEK293T cells; OVER: cells transiently transfected with a luciferase-mCherry-CRY2 vector; XP: cells transfected with an XPACK-luciferase-mCherry vector; and EXPLOR: cells transfected with both luciferase-mCherry-CRY2 and CIBN-EGFP-CD9 vectors. ( c ) Cells transiently transfected with various vectors were maintained for 48 h. In the case of EXPLOR-producing cells, cells were maintained in the absence (OFF) or presence (ON) of blue light illumination; 5 × 10 8 particles of the isolated exosomes were analysed for luciferase activity. Data are presented as the mean±s.e.m. ( n =3), and Tukey's post hoc test was applied to significant group effects (** P <0.01, *** P <0.001) identified by ANOVA. ( d ) Loading efficiency of various protein-loaded exosomes was calculated by dividing the number of luciferase molecules in exosomes with the number of luciferase molecules in the exosome-producing cells. Numbers of luciferase molecules were estimated from a standard curve using recombinant luciferase. Data are presented as the mean±s.e.m. ( n =3), and Tukey's post hoc test was applied to significant group effects (*** P <0.001) identified by ANOVA. NS, not significant.

Article Snippet: Primary antibody sources were as follows: mouse monoclonal mCherry antibody (diluted 1:1,000 for western blotting, 1:50 for EM, ab125096), rabbit monoclonal CD9 antibody (diluted 1:50 for EM, ab92726) and NF-κB antibodies (diluted 1:1,000 for immunocytochemistry, ab16502) were obtained from Abcam (Cambridge, MA, USA); CD63 (diluted 1:1,000 for western blotting, sc-15363) and GAPDH (diluted 1:4,000 for western blotting, sc-25778) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); cytochrome c antibody (diluted 1:1,000 for immunocytochemistry, 556432) was from BD biosciences (San Jose, CA, USA); and the GFP antibody (diluted 1:1,000 for western blotting, 2555) was from Cell Signaling Technology (Beverly, MA, USA).

Techniques: Transfection, Luciferase, Expressing, Plasmid Preparation, Fluorescence, Microscopy, Control, Isolation, Activity Assay, Recombinant

Journal: Nature Communications

Article Title: Exosome engineering for efficient intracellular delivery of soluble proteins using optically reversible protein–protein interaction module

doi: 10.1038/ncomms12277

Figure Lengend Snippet: ( a , b ) HeLa cells were incubated in the absence or presence of 5 × 10 9 particles of various isolated exosomes for 24 h and imaged by fluorescence microscopy. The fluorescence intensities of mCherry were quantified by two imaging processing tools, ImageJ and Cellprofiler. Data are presented as the mean±s.e.m. ( n =15), and Tukey's post hoc test was applied to significant group effects (*** P <0.001) identified by analysis of variance (ANOVA). Scale bars, 100 μm. ( c , d ) HeLa cells were incubated in the absence or presence of 0.1 mg ml −1 mCherry:EXPLORs or Bax-mCherry:EXPLORs for 12 h, and fixed with 4% paraformaldehyde. Then, cytochrome c was stained with an antibody conjugated with Alexa Fluor 647 and imaged by confocal microscopy. The ratios of cytochrome c localization were analysed by cell counting. Data are presented as the mean±s.e.m. ( n =3), and Tukey's post hoc test was applied to significant group effects (** P <0.01) identified by ANOVA. Scale bars, 20 μm. ( e ) HeLa cells were incubated in the absence or presence of 0.1 mg ml −1 mCherry:EXPLORs or srIκB:EXPLORs for 12 h, treated with 10 ng ml −1 tumour necrosis factor- α (TNF-α) for an additional 30 min, and fixed with 4% paraformaldehyde. NF-κB p65 was stained with an antibody conjugated with Alexa Fluor 488 and imaged by confocal microscopy. ( f ) The nuclear extracts of cells were assayed for the DNA-binding activity of p65/c-Rel (NF-κB). Data are presented as the mean±s.e.m. ( n =3), and Tukey's post hoc test was applied to significant group effects (** P <0.01) identified by ANOVA. Scale bars, 20 μm. NS, not significant.

Article Snippet: Primary antibody sources were as follows: mouse monoclonal mCherry antibody (diluted 1:1,000 for western blotting, 1:50 for EM, ab125096), rabbit monoclonal CD9 antibody (diluted 1:50 for EM, ab92726) and NF-κB antibodies (diluted 1:1,000 for immunocytochemistry, ab16502) were obtained from Abcam (Cambridge, MA, USA); CD63 (diluted 1:1,000 for western blotting, sc-15363) and GAPDH (diluted 1:4,000 for western blotting, sc-25778) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); cytochrome c antibody (diluted 1:1,000 for immunocytochemistry, 556432) was from BD biosciences (San Jose, CA, USA); and the GFP antibody (diluted 1:1,000 for western blotting, 2555) was from Cell Signaling Technology (Beverly, MA, USA).

Techniques: Incubation, Isolation, Fluorescence, Microscopy, Imaging, Staining, Confocal Microscopy, Cell Counting, Binding Assay, Activity Assay

Journal: bioRxiv

Article Title: Oligomerization and cellular localization of SLC26A11

doi: 10.1101/2024.04.29.591613

Figure Lengend Snippet: A – F , Confocal images of HEK293T cells ( A, C and E ) and B-ICC Clone C cells ( B, D and F ) co-expressing SLC26A4/pendrin, SLC26A7 and SLC26A11 together with the lysosomal marker Lamp1 or the ER marker Calnexin. G and H , box plot of Manders coefficients of colocalization analysis between SLC26A4/pendrin, SLC26A7 and SLC26A11 with the corresponding intracellular marker (SLC26A11/Lamp1 HEK293T , n = 20; SLC26A11/Lamp1 CloneC , n = 20; SLC26A11/Calnexin HEK293T , n = 19; SLC26A11/Calnexin CloneC , n = 18); (SLC26A4/Lamp1 HEK293T , n = 20; SLC26A4/Lamp1 CloneC , n = 14; SLC26A4/Calnexin HEK293T , n = 18; SLC26A4/Calnexin CloneC , n = 15); (SLC26A7/Lamp1 HEK293T , n = 25; SLC26A7/Lamp1 CloneC , n = 23; SLC26A7/Calnexin HEK293T , n = 25; SLC26A7/Calnexin CloneC , n = 21); One-way ANOVA (Tukey’s HSD post hoc test). Data are presented as means ± S.D. with n being the number of co-transfected cells analyzed. In boxplots, boxes indicate the upper and lower quartiles, and whiskers the upper and lower 90 percentiles. Scale bars = 10 µm.

Article Snippet: We received the lysosomal marker Lamp1 as a gift from Walter Mothes, Addgene plasmid #1817 , and the ER marker Calnexin as gift from Michael Davidson ( http://n2t.net/addgene:55005 ; RRID: Addgene_55005).

Techniques: Expressing, Marker, Transfection

Journal: The EMBO Journal

Article Title: NALCN ‐mediated sodium influx confers metastatic prostate cancer cell invasiveness

doi: 10.15252/embj.2022112198

Figure Lengend Snippet: Co‐localisation of NALCN with invadopodia markers – Dynamin, Src and Tks: confocal images (left), 2D intensity histograms (middle) and statistical analysis (right). Scale bar: 5 μm. NALCN silencing suppresses invadopodial precursor assembly. Left: near‐cell‐bottom confocal images captured before and 3 min after stimulation with 10% fetal bovine serum (FBS). Arrows: F‐actin‐enriched regions reported by LifeAct‐mCherry. Middle: corresponding traces of relative changes in mCherry fluorescence. Right: mean rates of F‐actin formation. Top: temporal profiles of self‐normalized fluorescence intensity (ΔF/F 0 ) of fluo‐4 (green), averaged within outlined region (inset: left, green outline), and mCherry (red), averaged within 14 circles (inset: right, red outlines). Middle: galleries show confocal images of fluo‐4 and mCherry fluorescence captured during two periods of interests, POIs (blue bars): for POI1‐ every image, for POI2 ‐ every 100 th image. Bottom left: confocal images of Dynamin2‐mCherry fluorescence captured before and 3 min after stimulation with 10% FBS. Bottom middle and right: plots relate the dynamics of [Ca 2+ ] c changes (Fluo‐4) to formation of dynamin puncta (Dynamin2‐mCherry) at two regions of interests (ROIs) (insets); the galleries (below) show every 40 th image (after 90° rotation) during the POIs (plots: blue bars). Top the overlay of NALCN‐GFP and Cal‐590 images is related to the gallery of self‐normalized rainbow‐coded Cal‐590 images showing [Ca 2+ ] c response to 10% FBS. Bottom: 3 rainbow‐coded Cal‐590 images are superimposed on gray‐coded NALCN‐GFP image and rotated by 90°. Arrows: NALCN‐enriched structure. Data information: The colocalization intensity (A) was measured using Pearson's correlation coefficient with Fiji ImageJ software. Bar diagram plots show mean ± SEM: (A) Pearson's correlation coefficient as a measure of co‐localization with NALCN of Dynamin ( n = 4), Src ( n = 14) and Tks ( n = 4), and (B) Mean rates of F‐actin formation estimated as signal mass ( ∫ Δ F / F 0 ) of mCherry fluorescence per second in cells transfected with siCTL ( n = 93) and with siNALCN ( n = 140). n = number of cell *** P < 0.001, unpaired two‐tailed Student's t ‐test. Source data are available online for this figure.

Article Snippet: The human NALCN cDNA was previously described (Swayne et al , ) and the mCherry cDNA was obtained from the pAAV‐EF1a‐mCherry plasmid (Addgene #114470).

Techniques: Fluorescence, Software, Transfection, Two Tailed Test

Journal: The EMBO Journal

Article Title: NALCN ‐mediated sodium influx confers metastatic prostate cancer cell invasiveness

doi: 10.15252/embj.2022112198

Figure Lengend Snippet: Left: confocal images of PH‐PLC ∂1 ‐ GFP fluorescence captured before and 1 min after stimulation with 10% FBS, and their rainbow‐coded 3D shaded‐surface plots. Right: corresponding traces of relative (R = F plasmalemma /F cytosol ) changes in GFP fluorescence (green), reflecting translocation PH‐PLC ∂1 from the plasma membrane to cytosol caused by PI(4,5)P 2 degradation, and in Cal‐590 fluorescence (red) reflecting [Ca 2+ ] c dynamics. Left: near cell bottom confocal (< 0.8 μm) images of wGBD ‐ RFP fluorescence before and 2 min after stimulation with 10% FBS. Note puncta formation (arrows) reflecting spots where Cdc42 is activated to bind N‐WASP. Right: corresponding traces of relative changes in RFP fluorescence (red), reflecting the dynamics of Cdc42 activation, and in Fluo‐4 fluorescence (green) reflecting [Ca 2+ ] c dynamics. Left: near cell bottom confocal (< 0.8 μm) images of PC‐3 cell transfected with F‐actin marker LifeAct ‐ mCherry were captured before and 3 min after stimulation with 10% FBS. Note F‐actin‐enriched structures (arrows) induced by stimulation with FBS. Right: corresponding traces of relative changes in mCherry fluorescence (red), reflecting F‐actin dynamics, and in Fluo‐4 fluorescence (green) reflecting [Ca 2+ ] c dynamics. Left: near cell bottom confocal (< 0.8 μm) images of PC‐3 cell transfected with Dynamin 2 ‐ mCherry were captured before and 2 min after stimulation with 10% FBS. Note dynamin puncta (arrows) induced by stimulation with FBS. Right: corresponding traces of relative changes in mCherry fluorescence (red) reflecting the dynamics of the dynamin puncta formation and in Fluo‐4 fluorescence (green) reflecting [Ca 2+ ] c dynamics. Data information: The galleries below the plots show images (A) or enlarged boxed regions of the images (B–D) captured during the periods highlighted on the plots by gray background: every 3 rd image (A–C), every 35 th image (D). Source data are available online for this figure.

Article Snippet: The human NALCN cDNA was previously described (Swayne et al , ) and the mCherry cDNA was obtained from the pAAV‐EF1a‐mCherry plasmid (Addgene #114470).

Techniques: Fluorescence, Translocation Assay, Clinical Proteomics, Membrane, Activation Assay, Transfection, Marker

Journal: Cell

Article Title: Periodic ER-plasma membrane junctions support long-range Ca 2+ signal integration in dendrites.

doi: 10.1016/j.cell.2024.11.029

Figure Lengend Snippet: Figure 1. ER-PM contact sites tile the plasma membrane of hippocampal neurons at regular intervals in vitro and in vivo (A) Schematic illustration of a primary pyramidal hippocampal neuron emphasizing distinct dendritic regions: proximal dendrites (0.5–4.1 mm in diameter), medial dendrites (0.3–1.2 mm in diameter), and distal dendrites (0.1–0.76 mm in diameter). (B) Lattice-SIM image portrays the organization of dendritic ER (expression of HaloTag [HT]-Sec61b labeled with JF635 HaloTag ligand) in a primary rat hip- pocampal neuron at 21 days in vitro (DIV). In proximal (P) and medial (M) dendritic segments, we observed a ladder-like organization of the ER, as highlighted in the corresponding insets. Scale bar: 5 mm main panel, 0.5 mm insets. (C) Lattice-SIM images of proximal, medial, and distal neuronal dendrites expressing mEmerald-Sec61b (ER; grayscale) and mScarlet-CAAX2 (PM; blue). Scale bar: 1 mm.

Article Snippet: The AAV vector pAAV hSyn INTRON mCherry-JPH3 WPRE, expressing human Jph3 gene fused to the fluorescent protein mCherry, was generated by subcloning the cORF of mCherry-JPH3, a kind gift from Kurt Beam (University of Colorado School of Medicine, CO, USA), into our AAV template backbone (Addgene #196041) at BamHI and HindIII cloning sites. pAAV hSyn INTRON HaloTag-JPH3 WPRE was generated replacing mCherry with HaloTag (from Addgene #123285) at BglII and HindIII sites. pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV2.1 WPRE, pLenti_SIV-(SalI)-syn-IRESmEmerald-CaV2.2 WPRE and pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV1.2 WPRE were generated cloning CaV2.1, CaV2.2 and CaV1.2 cORF fused to mEmerald at the N-terminus in a third-generation, simian immunodeficiency based, pro-lentiviral vector92 Cell 188, 484–500.e1–e12, January 23, 2025 e5 ll OPEN ACCESS Article at AgeI and HpaI sites.

Techniques: Clinical Proteomics, Membrane, In Vitro, In Vivo, Expressing, Labeling

Journal: Cell

Article Title: Periodic ER-plasma membrane junctions support long-range Ca 2+ signal integration in dendrites.

doi: 10.1016/j.cell.2024.11.029

Figure Lengend Snippet: Figure 3. Regularly distributed ER-PM junctions persist under major cytoskeletal perturbations (A) Time-lapse acquired using 2D lattice-SIM in burst mode of HaloTag-Sec61b (labeled with JF585 HaloTag ligand) expressing neurons revealing ER tubule dynamicity with the persistent presence of ER-PM junctional sites (marked with magenta asterisks; see Video S3). Scale bar: 0.5 mm. (B) Neuronal dendrite expressing mCherry-JPH3, mEmerald-Sec61b, and mTagBFP2-CAAX2 (blue outline) following hypotonic swelling (63 mOsM solution). Gray arrowheads indicate JPH3 puncta localized on opposite sides of ER vesicles. Scale bar: 1 mm, inset 0.5 mm. (C) Average mCherry-JPH3 contact sites interval after treatment with strong hypotonic solution (0.97 ± 0.15 mm, N = 16, 2 independent experiments, mean ± SD). (D) Time-lapse series acquired using Lattice-SIM of mEmerald-Sec61b-expressing neurons. Lysosomes were stained using LysoView 650. Lysosomes move through ladder-like ER arrays (see arrow and Video S4). Scale bar: 0.5 mm. (E) 3D renderings of ER (green), plasma membrane (blue), and mitochondria (pink) in medial dendrites of mouse hippocampus. Black arrows indicate ER rungs. Scale bar: 1 mm. (F and G) 3D renderings of ER (green), plasma membrane (blue), and mitochondria (pink) in Drosophila MBON1 neuron segmented from FIB-SEM datasets. The white box frames a mitochondrion extending through multiple ER rungs. Scale bars: 1 mm.

Article Snippet: The AAV vector pAAV hSyn INTRON mCherry-JPH3 WPRE, expressing human Jph3 gene fused to the fluorescent protein mCherry, was generated by subcloning the cORF of mCherry-JPH3, a kind gift from Kurt Beam (University of Colorado School of Medicine, CO, USA), into our AAV template backbone (Addgene #196041) at BamHI and HindIII cloning sites. pAAV hSyn INTRON HaloTag-JPH3 WPRE was generated replacing mCherry with HaloTag (from Addgene #123285) at BglII and HindIII sites. pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV2.1 WPRE, pLenti_SIV-(SalI)-syn-IRESmEmerald-CaV2.2 WPRE and pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV1.2 WPRE were generated cloning CaV2.1, CaV2.2 and CaV1.2 cORF fused to mEmerald at the N-terminus in a third-generation, simian immunodeficiency based, pro-lentiviral vector92 Cell 188, 484–500.e1–e12, January 23, 2025 e5 ll OPEN ACCESS Article at AgeI and HpaI sites.

Techniques: Labeling, Expressing, Staining, Clinical Proteomics, Membrane

Journal: Cell

Article Title: Periodic ER-plasma membrane junctions support long-range Ca 2+ signal integration in dendrites.

doi: 10.1016/j.cell.2024.11.029

Figure Lengend Snippet: Figure 4. Junctophilin-3 coordinates the recruitment of voltage-gated calcium channels to ER-PM contact sites (A and B) Airyscan images showing mEmerald-CaV2.1 (A) and mEmerald-CaV2.2 (B) localize at the plasma membrane (visualized with mScarlet-CAAX2) of dendrites in primary rat hippocampal neurons. mEmerald-CaV2.1 and mEmerald-CaV2.2 accumulated in regularly interspaced puncta (inset). Scale bar: 5 mm, inset: 1 mm. (C) mEmerald-CaV2.1 and mEmerald-CaV2.2 colocalized with HaloTag-JPH3 contacts in neuronal dendrites. Scale bar: 1 mm. (D) mEmerald-CaV2.1 and mEmerald-CaV2.2 puncta were observed in approximately 70.7% ± 2.7% (N = 18, 5 independent experiments) and 68.0% ± 3.2% (N = 16, 4 independent experiments) of JPH3-positive contacts, respectively, along the dendritic tree. (E) Knockdown (KD) of JPH3 resulted in the loss of mEmerald-CaV2.1 and mEmerald-CaV2.2 clusters in dendrites. Neurons expressing shRNA for JPH3 were identified by cytosolic expression of mTagBFP2. Scale bars: 2 mm.

Article Snippet: The AAV vector pAAV hSyn INTRON mCherry-JPH3 WPRE, expressing human Jph3 gene fused to the fluorescent protein mCherry, was generated by subcloning the cORF of mCherry-JPH3, a kind gift from Kurt Beam (University of Colorado School of Medicine, CO, USA), into our AAV template backbone (Addgene #196041) at BamHI and HindIII cloning sites. pAAV hSyn INTRON HaloTag-JPH3 WPRE was generated replacing mCherry with HaloTag (from Addgene #123285) at BglII and HindIII sites. pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV2.1 WPRE, pLenti_SIV-(SalI)-syn-IRESmEmerald-CaV2.2 WPRE and pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV1.2 WPRE were generated cloning CaV2.1, CaV2.2 and CaV1.2 cORF fused to mEmerald at the N-terminus in a third-generation, simian immunodeficiency based, pro-lentiviral vector92 Cell 188, 484–500.e1–e12, January 23, 2025 e5 ll OPEN ACCESS Article at AgeI and HpaI sites.

Techniques: Clinical Proteomics, Membrane, Knockdown, Expressing, shRNA

Journal: Cell

Article Title: Periodic ER-plasma membrane junctions support long-range Ca 2+ signal integration in dendrites.

doi: 10.1016/j.cell.2024.11.029

Figure Lengend Snippet: Figure 5. pCaMKII accumulates at ER-PM junctions upon neuronal stimulation (A) Protocols used to detect pCaMKII and CaMKIIa at ER-PM junctions using a paradigm that maximizes the contribution of voltage-gated Ca2+ channels to depolarization-induced Ca2+ entry. (B) Dendrites expressing mTagBFP2-CAAX2 to visualize dendritic plasma membrane (blue outline) and mCherry-JPH3 to visualize ER-PM junctions were promptly fixed and stained for pCaMKII under different conditions: 5 mM K+, stimulation with 90 mM K+, and 90 mM K+ with CaV blockers: the L-type CaV blocker nimodipine (10 mM), the P/Q-type CaV blocker u-Agatoxin IVA (500 nM), and the N-type CaV blocker u-Conotoxin GVIA (2 mM). The background signal of pCaMKII staining was subtracted to highlight hotspots (see STAR Methods). Scale bars: 1 mm. (C) pCaMKII hotspots per mm2 of dendritic area in 5 mM K+ = 0.02 ± 0.01 hotspots/mm2, 90 mM K+ = 1.2 ± 0.04 hotspots/mm2, 90 mM K+ + CaV block = 0.36 ± 0.06 hotspots/mm2, N = 12, 3 independent experiments. (D) JPH3 contacts density in dendrites in each stimulation paradigm: 5 mM K+ = 1.08 ± 0.08 contacts/mm2, 90 mM K+ = 1.14 ± 0.06 contacts/mm2, 90 mM K+ + CaV block = 1.03 ± 0.06 contacts/mm2, N = 12, 3 independent experiments. (E) Fraction of HaloTag-JPH3 contacts colocalizing with pCaMKII hotspots in 5 mM K+ = 0.67% ± 0.49%, 90 mM K+ = 62.44% ± 4.02%, 90 mM K+ + CaV block = 3.88% ± 0.98%, N = 12, 3 independent experiments. All data are mean ± SEM and were analyzed with one-way ANOVA and Tukey’s multiple comparison tests; **** p < 0.0001. See also Figure S5.

Article Snippet: The AAV vector pAAV hSyn INTRON mCherry-JPH3 WPRE, expressing human Jph3 gene fused to the fluorescent protein mCherry, was generated by subcloning the cORF of mCherry-JPH3, a kind gift from Kurt Beam (University of Colorado School of Medicine, CO, USA), into our AAV template backbone (Addgene #196041) at BamHI and HindIII cloning sites. pAAV hSyn INTRON HaloTag-JPH3 WPRE was generated replacing mCherry with HaloTag (from Addgene #123285) at BglII and HindIII sites. pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV2.1 WPRE, pLenti_SIV-(SalI)-syn-IRESmEmerald-CaV2.2 WPRE and pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV1.2 WPRE were generated cloning CaV2.1, CaV2.2 and CaV1.2 cORF fused to mEmerald at the N-terminus in a third-generation, simian immunodeficiency based, pro-lentiviral vector92 Cell 188, 484–500.e1–e12, January 23, 2025 e5 ll OPEN ACCESS Article at AgeI and HpaI sites.

Techniques: Expressing, Clinical Proteomics, Membrane, Staining, Blocking Assay, Comparison

Journal: Cell

Article Title: Periodic ER-plasma membrane junctions support long-range Ca 2+ signal integration in dendrites.

doi: 10.1016/j.cell.2024.11.029

Figure Lengend Snippet: Figure 6. Regular ER-PM contact sites host ER Ca2+ uptake and release machinery (A) Dendrite expressing HaloTag-STIM2 (HT-STIM2) with the ER marker mEmerald-ER. HaloTag-STIM2 accumulated at regularly distributed contacts in den- drites. Scale bar: 2 mm. (B) Primary neuronal dendrite co-expressing HaloTag-STIM1 (HT-STIM1) with the ER marker mEmerald-ER showed HaloTag-STIM1 distribution within ER rungs. Scale bar: 2 mm. (C) HaloTag-STIM2 colocalized with regularly spaced mCherry-JPH3 contacts in neuronal dendrites. Inset and fluorescence intensity plot profiles emphasize the overlap between JPH3 hotspots and STIM2 clusters. Scale bar: 1 mm main image, 0.25 mm inset. (D) HaloTag-STIM2 populated 78.7% ± 2.4% of JPH3-positive contacts in neuronal dendrites (N = 13, 3 independent experiments). (E) Co-overexpression of mCherry-JPH3, HaloTag-STIM2, and mEmerald-CaV2.1 showed the colocalization of these molecules at regular ER-PM dendritic contacts. Scale bar: 0.5 mm. (F) Immunofluorescence experiments revealed the colocalization of RyRs puncta with JPH3-positive ER-PM junctions throughout proximal, medial, and distal dendrites. Inset and fluorescence intensity plot profiles emphasize the overlap between JPH3 and RyRs clusters. Scale bar: 1 mm main image, 0.25 mm inset. (G) RyRs puncta populated 50.3% ± 3.1% of JPH3 contacts in dendrites (N = 11, 2 independent experiments, mean ± SEM). (H) Immunofluorescence experiments revealed the colocalization of RyRs, HaloTag-JPH3, and mEmerald-CaV2.1 at periodic ER-PM contacts in dendrites. Scale bar: 0.2 mm. (I) Schematic illustrating the molecular components of ER Ca2+ uptake and release machinery populating regularly distributed ER-PM contacts in dendrites. Data are reported as mean ± SEM. Constructs fused to HaloTag were labeled with JF635 or JF647. See also Figure S6.

Article Snippet: The AAV vector pAAV hSyn INTRON mCherry-JPH3 WPRE, expressing human Jph3 gene fused to the fluorescent protein mCherry, was generated by subcloning the cORF of mCherry-JPH3, a kind gift from Kurt Beam (University of Colorado School of Medicine, CO, USA), into our AAV template backbone (Addgene #196041) at BamHI and HindIII cloning sites. pAAV hSyn INTRON HaloTag-JPH3 WPRE was generated replacing mCherry with HaloTag (from Addgene #123285) at BglII and HindIII sites. pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV2.1 WPRE, pLenti_SIV-(SalI)-syn-IRESmEmerald-CaV2.2 WPRE and pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV1.2 WPRE were generated cloning CaV2.1, CaV2.2 and CaV1.2 cORF fused to mEmerald at the N-terminus in a third-generation, simian immunodeficiency based, pro-lentiviral vector92 Cell 188, 484–500.e1–e12, January 23, 2025 e5 ll OPEN ACCESS Article at AgeI and HpaI sites.

Techniques: Expressing, Marker, Over Expression, Construct, Labeling

Journal: Cell

Article Title: Periodic ER-plasma membrane junctions support long-range Ca 2+ signal integration in dendrites.

doi: 10.1016/j.cell.2024.11.029

Figure Lengend Snippet: Figure 7. Regularly distributed ER-PM con- tacts allow RyR-dependent long-distance propagation of Ca2+ signals in dendrites (A) Illustration depicting the experiments monitoring ER Ca2+ dynamics in dendrites localized 70 mm away from the cell body of primary hippocampal neurons expressing ER-GCaMP6-210 upon two- photon glutamate uncaging. (B) Representative temporal profile of dendritic ER Ca2+ release following 6 pulses of glutamate un- caging. The burgundy squares indicate the gluta- mate uncaging events. (C) Dendrite expressing ER-GCaMP6-210 and PSD95-mCherry. The average plot of the control and ryanodine kymographs illustrate the ER Ca2+

Article Snippet: The AAV vector pAAV hSyn INTRON mCherry-JPH3 WPRE, expressing human Jph3 gene fused to the fluorescent protein mCherry, was generated by subcloning the cORF of mCherry-JPH3, a kind gift from Kurt Beam (University of Colorado School of Medicine, CO, USA), into our AAV template backbone (Addgene #196041) at BamHI and HindIII cloning sites. pAAV hSyn INTRON HaloTag-JPH3 WPRE was generated replacing mCherry with HaloTag (from Addgene #123285) at BglII and HindIII sites. pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV2.1 WPRE, pLenti_SIV-(SalI)-syn-IRESmEmerald-CaV2.2 WPRE and pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV1.2 WPRE were generated cloning CaV2.1, CaV2.2 and CaV1.2 cORF fused to mEmerald at the N-terminus in a third-generation, simian immunodeficiency based, pro-lentiviral vector92 Cell 188, 484–500.e1–e12, January 23, 2025 e5 ll OPEN ACCESS Article at AgeI and HpaI sites.

Techniques: Expressing, Control

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 1. Ablation of Nck (noncatalytic region of tyrosine kinase) 1 and Nck2 adaptor proteins reduces shear stress– induced endothelial permeability. A, Representative blots showing the efficiency of the knocking down of Nck1/2 in human aortic endothelial cells (HAECs) after Nck1/2 short hairpin RNA (shRNA) or scrambled shRNA control transduction. B and C, PECAM-1 (platelet endothelial cell adhesion molecule-1; white)/ß-catenin (red)–stained cells showing paracellular formation after oscillatory shear stress (OSS; ±5 dynes/cm2 with 1 dyne/cm2 forward flow) exposure. Images in the boxes indicate areas of higher magnifications, whereas areas in the dashed boxes indicate lower magnifications. Data analyzed by Kruskal-Wallis test (*P=0.03). White arrowheads indicate paracellular pores. D/E, Nck1/2 knocking down prevents flow-induced permeability using biotinylated gelatin/Alexa 647-streptavidin assay. 4′,6-Diamidino-2-phenylindole (blue; nuclei), phalloidin (green; F-actin fibers), and streptavidin (red; exposed biotinylated gelatin). Images analyzed using NIS-Elements software. Scale bars=50-100 μm. Data are from n=4 independent experiments. Data are reported using box and whisker plots and analyzed by 2-way ANOVA and Bonferroni posttest (***P<0.001).

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Shear, Permeability, shRNA, Control, Transduction, Staining, Software, Whisker Assay

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 2. Deletion of Nck 1 but not Nck2 adaptor protein blunts shear stress–induced endothelial permeability. A, Representative blots showing the efficiency of the knocking down of Nck1/2 in human aortic endothelial cells (HAECs) after Nck1 short hairpin RNA (shRNA), Nck2 shRNA, or scrambled shRNA control transduction. B and C, PECAM-1 (platelet endothelial cell adhesion molecule-1; white)/ß-catenin (red)–stained cells showing paracellular formation (white arrowheads) after oscillatory shear stress (OSS) exposure. D and E, Nck1 but not Nck2 knocking down prevents flow- induced permeability using biotinylated gelatin/Alexa 647-streptavidin assay. 4′,6-Diamidino-2-phenylindole (blue; nuclei), phalloidin (green; F-actin fibers), and streptavidin (red; exposed biotinylated gelatin). Images were analyzed using NIS- Elements software. Scale bars=50 to 100 μm. Data are from n=4 and analyzed as mean±SEM by 2-way ANOVA and Bonferroni posttest (*P<0.05, **P<0.01, ***P<0.001). Images in the boxes indicate areas of higher magnifications, whereas areas in the dashed boxes indicate lower magnifications.

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Shear, Permeability, shRNA, Control, Transduction, Staining, Software

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 3. Conditional endothelial deletion of Nck (noncatalytic region of tyrosine kinase) 1 but not Nck2 blunts partial carotid ligation–induced permeability. A, Schematic of targeting strategy to construct Nck1 fl/fl mice. Nucleotide substitutions were made in exon 2. Embryonic stem cells transfected with the targeting constructs were screened for homologous recombination by polymerase chain reaction (PCR). PCR showing heterozygous Nck1 fl/+ and homozygous Nck1 fl/fl mice with the expected products at 490 bp (targeted alleles) and wild-type (Nck1+/+) at 377 bp. B, Pulmonary endothelial cells isolated from different experimental groups after tamoxifen injection and 2 weeks’ recovery, Nck1 and Nck2 expression were assessed by immunoblotting n=2 per group. C, Schematic of the study in which 4 groups of mice were subjected to the ligation surgery as indicated animal genotypes and time of surgery. D, Nck1 but not Nck2 knockout mice showed less Evans blue extravasation and (E) fluorescein isothiocyanate (FITC)-dextran in ng/μL after ligation, n=5 or 6 per group. Data are expressed as mean±SEM and analyzed by 2-way ANOVA and Bonferroni posttest (*P<0.05, **P<0.01) cKO indicates conditional knockouts; M, marker; Neo, neomycin; SDA, self-deletion anchor site.

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Ligation, Permeability, Construct, Transfection, Homologous Recombination, Polymerase Chain Reaction, Isolation, Injection, Expressing, Western Blot, Knock-Out, Marker

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 4. SH3 domains of Nck (noncatalytic region of tyrosine kinase) 1 are essential for flow-induced endothelial permeability. A, Schematic showing the domain structure of Nck1 and Nck2 and 2 chimera of Nck1 SH2/SH3 and Nck1 SH3/Nck2 SH2. B, Western blot analysis showing comparable Nck1/2 re-expression following transduction of constructs in (A) in Nck1/2 double knockout (DKO) cells. C and D, Permeability of endothelial cells after oscillatory shear stress (OSS) as assessed by streptavidin-biotinylated gelatin trapping assay. Data are analyzed by 2-way ANOVA and Bonferroni posttest (*P<0.05; ns, nonsignificant, from n=4). E, Schematic diagram suggesting that Nck1/2 bind to PECAM-1 (platelet endothelial cell adhesion molecule-1) in response to shear stress, but only Nck1 through its SH3 domains regulates the permeability.

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Permeability, Western Blot, Expressing, Transduction, Construct, Double Knockout, Shear

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 5. Nck (noncatalytic region of tyrosine kinase) 1 and Nck2 bind to PECAM-1 (platelet endothelial cell adhesion molecule-1) in response to shear stress but Nck1 is required for bridging PAK (p21-activated kinase) 2/PECAM-1 and activation. A, Immunoblotting showing PECAM-1 coimmunoprecipitations and confirms the interactions with Nck1 and Nck2 are shear stress dependent. B, Graphical representation of the levels of Nck1 in PECAM-1 coimmunopreciptation showing statistical significance. C, Immunofluorescence staining to PECAM-1 (red) and Nck1/2 (green) after shears stress. Scale bar=50 μm. D, phospho-PAK2 is detected in PECAM-1 coimmunopreciptation and (E) PAK membrane translocation and PECAM-1 binding is enhanced by shear stress and impaired after knocking down of Nck1. F and G, PAK2 activation as assessed by phosphorylation is downregulated by Nck1 ablation but not by Nck2 deletion. Western blots are from n=4 independent experiments. Data are mean±SEM analyzed by either 1-way ANOVA and Tukey posttest or 2-way ANOVA and Bonferroni posttest (*P<0.05, ****P<0.0001).

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Shear, Activation Assay, Western Blot, Immunofluorescence, Staining, Membrane, Translocation Assay, Binding Assay, Phospho-proteomics

Journal: Journal of the American Heart Association

Article Title: Nck1, But Not Nck2, Mediates Disturbed Flow‐Induced p21‐Activated Kinase Activation and Endothelial Permeability

doi: 10.1161/jaha.120.016099

Figure Lengend Snippet: Figure 6. Nck (noncatalytic region of tyrosine kinase) 1 first SH3 domain regulates PAK2 (p21-activated kinase 2)-induced endothelial permeability. A, Schematic of Nck1 point mutations in each of the SH3 domains and the nomenclature used to inactivation of SH3 domains. B, Lysates from human aortic endothelial cells (HAECs) transiently transfected with Nck1 variants with inactivated SH3 domains. C and D, Flow- induced permeability using biotinylated gelatin/Alexa 647-streptavidin assay. 4′,6-Diamidino-2-phenylindole (blue; nuclei), phalloidin (green; F-actin fibers), and streptavidin (red; exposed biotinylated gelatin) Images analyzed using NIS-Elements software from n=4. Scale bar=200 μm. Data were reported as box and whiskers with scatter plots and analyzed by Kruskal–Wallis test (*P<0.05,**P<0.01, ***P<0.001). E, Lysates and graphical quantifications from HAECs Nck1/2 double knockout (DKO) transiently transfected with either hNck1 or Nck1 SH3.1* and were immunoprecipitated for PECAM-1 (platelet endothelial cell adhesion molecule-1). Blotted for phospho- PAK2 S141. F, HAECs Nck1/2 DKO either transfected with hNck1 or Nck1 SH3.1* were lyzed after shear stress exposure (0–30 minutes) and immunoblotted for phospho-PAK2 S141 and GAPDH served as a loading control. Data are from n=3-4, expressed as mean±SEM, and analyzed by 2-way ANOVA and Bonferroni posttest (*P<0.05,****P<0.0001).

Article Snippet: The lentiviral vectors included pLV- (shRNA)- mCherry:T2A:Puro- U6 for Nck1 (target seq: GGGTTCTCTGTCAGAGAAA) and Nck2 (target seq: CTTAAAGCGTCAGGGAAGA) with third- generation lentivirus components provided from Didier Trono; pMD2.G (Addgene #12259), pRSVRev (Addgene #12253), and pMDLg/pRRE (Addgene #12251).26 The lentiviral CRISPR/Cas9 plasmids utilized the pLV[CRISPR]- hCas9:T2A:Puro- U6>gRNA with the single- guide RNA sequences targeting Nck1 (target seq: GTCGTCAATAACCTAAATAC), Nck2 (target seq: TGACGCGCGACCCCTTCACC) or scrambled singleguide RNA (target seq: GCACTACCAGAGCTAACTCA).

Techniques: Permeability, Transfection, Software, Double Knockout, Immunoprecipitation, Shear, Control

Journal: Molecular Biology of the Cell

Article Title: Coordinated changes in cell membrane and cytoplasm during maturation of apoptotic bleb

doi: 10.1091/mbc.E19-12-0691

Figure Lengend Snippet: The dynamic behavior of membrane blebs changes with the progression of apoptosis. (A) Migratory blebs and apoptotic blebs of DLD1 cells stably expressing FlipGFP(casp3)-T2A-mCherry, a GFP-based fluorogenic caspase-3 reporter. When DLD1 cells were seeded on Type I Collagen gel, they actively formed blebs and moved around freely (top). DLD1 cells were treated with 250 ng/ml anti-Fas antibody and 10 mg/ml cycloheximide for 2 h (Early stage) or 4 h (Late stage) to induce apoptosis (bottom). Results shown are representative of three independent experiments. Scale bar, 10 μm. (B) DLD1 cells were transfected with Lifeact-RFP. DLD1 cells actively formed blebs and moved around freely (left). DLD1 cells were treated with 250 ng/ml anti-Fas antibody and 10 mg/ml cycloheximide for 2 h (Early stage) or 4 h (Late stage) to induce apoptosis (right). Results shown are representative of five independent experiments. Scale bar, 10 μm. (C) The retraction velocities of membrane blebs in freely moving DLD1 cells and apoptotic DLD1 cells were quantified. The speed of the retraction phase of membrane blebs of apoptotic cells in the late stage was slower than that in early stage. Error bars indicate the SD calculated based on the values from N = 10 independent blebs. ** P < 0.01, **** P < 0.0001 (one-way analysis of variance [ANOVA]). (D) The sizes of membrane blebs in freely moving DLD1 cells and apoptotic DLD1 cells were quantified. The size of membrane blebs of apoptotic cells in the late stage was significantly larger than that in early stage. Error bars are SD of N = 10 independent blebs. **** P < 0.0001 (one-way ANOVA). (E) The frequencies of membrane blebs in freely moving DLD1 cells and apoptotic DLD1 cells during 10 min were quantified. The number of blebs formed during 10 min in apoptotic cells in the late stage was significantly fewer than that in early stage. Error bars are SD of N = 10 independent blebs. ** P < 0.01, **** P < 0.0001 (one-way ANOVA). (F) (Top panel) Membrane blebbing of DLD1 cells transfected with Cytochrome C-GFP and Lifeact–RFP from the early stage to the late stage of apoptosis. Cells were treated with 250 ng/ml anti-Fas antibody and 10 mg/ml cycloheximide for 2 h (Early stage) and 4 h (Late stage). Bottom panel: membrane blebbing of DLD1 cells transfected with Cytochrome C-GFP and Lifeact–RFP from the early stage to the late stage of apoptosis under ROCK inhibition. Cells were treated with 250 ng/ml anti-Fas antibody, 10 mg/ml cycloheximide, and 10 µM Y-27632 for 2 h (Early stage) and 4 h (Late stage). Results shown are representative of three independent experiments. Scale bar, 10 μm. (G) Top panel: Membrane blebbing of DLD1 cells stained with AnnexinV-Cy3 from the early stage to the late stage of apoptosis. Cells were treated with 250 ng/ml anti-Fas antibody and 10 mg/ml cycloheximide for 2 h (Early stage) and 4 h (Late stage). Bottom panel: membrane blebbing of DLD1 cells stained with AnnexinV-Cy3 from the early stage to the late stage of apoptosis under ROCK inhibition. Cells were treated with 250 ng/ml anti-Fas antibody, 10 mg/ml cycloheximide and 10 µM Y-27632 for 2 h (Early stage) and 4 h (Late stage). Results shown are representative of three independent experiments. Scale bar, 10 μm. (H) Top panel: membrane blebbing of DLD1 cells transfected with the calponin homology domain of utrophin (UtrCH)-GFP, a filamentous actin marker, and HMGB1-mScarlet from the early stage to the late stage of apoptosis. Cells were treated with 250 ng/ml anti-Fas antibody and 10 mg/ml cycloheximide for 2 h (Early stage) and 4 h (Late stage). Bottom panel: membrane blebbing of DLD1 cells transfected with LaminA–GFP and HMGB1-mScarlet from the early stage to the late stage of apoptosis. Cells were treated with 250 ng/ml anti-Fas antibody and 10 mg/ml cycloheximide for 2 h (Early stage) and 4 h (Late stage). White broken lines indicate margin of large blebs formed during the late phase of apoptosis. Results shown are representative of three independent experiments. Scale bar, 10 μm. (I) Top panel: membrane blebbing of DLD1 cells transfected with UtrCH-GFP and HMGB1-mScarlet from the early stage to the late stage of apoptosis under ROCK inhibition. Cells were treated with 250 ng/ml anti-Fas antibody, 10 mg/ml cycloheximide, and 10 µM Y-27632 for 2 h (Early stage) and 4 h (Late stage). Scale bar, 10 μm. Bottom panel: membrane blebbing of DLD1 cells transfected with LaminA-GFP and HMGB1-mScarlet from the early stage to the late stage of apoptosis under ROCK inhibition. Cells were treated with 250 ng/ml anti-Fas antibody, 10 mg/ml cycloheximide, and 10 µM Y-27632 for 2 h (Early stage) and 4 h (Late stage). Results shown are representative of three independent experiments. Scale bar, 10 μm. (J) DLD1 cells were left untreated or treated with 250 ng/ml anti-Fas antibody and 10 mg/ml cycloheximide for 4 h to induce apoptosis, either in the absence or in the presence of 10 µM Y-27632 or 50µM Z-VAD-FMK as indicated. Lysates were run on 10% SDS–PAGE and immunoblotted with anti-LaminA/C and α-tubulin antibodies. Cleaved LaminA/C and α-tubulin signals were quantified by densitometry to derive the ratio of cleaved LaminA/C to α-tubulin. The signal ratio of DLD1 cells treated with anti-Fas antibody and cycloheximide only (lane 2) was set to 1. Results shown are representative of three independent experiments. (K) The quantified means from N = 3 independent experiments of the signal ratio of cleaved LaminA/C to α-tubulin shown in J. Error bars indicate the SD. ** P < 0.01 (Student’s t test). (L) Quantitative analysis of changes in the number of nuclear fragments labeled with HMGB1-mScarlet from the early stage to the late stage of apoptosis. Cells were treated with 250 ng/ml anti-Fas antibody and 10 mg/ml cycloheximide with or without 10 µM Y-27632 for 5 h. The number of HMGB1-mScarlet fragments were counted every hour. The SD was calculated based on the values from N = 30 independent cells.

Article Snippet: The following primary antibodies were used for immunoblotting: mouse anti-ROCK1 antibody mAb (Abcam), mouse anti–α-tubulin mAb (Sigma), and rabbit anti-Lamin A/C antibody pAb (Cell Signaling Technology). cDNAs encoding full-length human Rnd3, human Anillin C terminus, human Xkr8ΔC, human Lamin A, and human 14-3-3β were amplified by RT-PCR, fused to the sequence encoding enhanced GFP or FLAG tag, and ligated into the pCAGGS-neo vector. pEGFP-CytochromeC and pcDNA3-FlipGFP (Casp3 cleavage seq) T2A mCherry were obtained from Addgene (No. 41181 and No. 124428).

Techniques: Membrane, Stable Transfection, Expressing, Transfection, Inhibition, Staining, Marker, SDS Page, Labeling

Journal: Molecular Biology of the Cell

Article Title: Coordinated changes in cell membrane and cytoplasm during maturation of apoptotic bleb

doi: 10.1091/mbc.E19-12-0691

Figure Lengend Snippet: The size of apoptotic blebs changes with the progression of apoptosis. In freely moving cells, bleb cycle is regulated by the double-negative feedback loop between Rnd3-p190RhoGAP and RhoA-ROCK1 (left). Rnd3-p190RhoGAP helps bleb growth by suppressing RhoA activation and actin polymerization during the expansion phase. On the other hand, RhoA-ROCK1 promotes actin reassembly during the retraction phase and also removes Rnd3 from the plasma membrane by phosphorylating Rnd3. During apoptosis, bleb cycle is also regulated this double-negative feedback loop between Rnd3-p190 RhoGAP and RhoA-ROCK1, but in the early stage of apoptosis, ROCK1 is activated by caspase-3 in a RhoA independent manner. Therefore, ROCK1 excludes Rnd3 from the plasma membrane and RhoA is more likely to be activated in the early stage of apoptosis, resulting in the acceleration of retraction of bleb and the reduction in the size of blebs. Caspase 3 also cleaves the C-terminal region of Xkr8, leading to constitutive activation of Xkr8. Owing to the phospholipid scrambling activity of Xkr8, PtdIns(4,5)P2 together with PS in the inner leaflet of the plasma membrane translocates to the outer leaflet of the plasma membrane. At the late stage of apoptosis, due to the phospholipid scrambling by Xkr8, the amount of PtdIns(4,5)P2 in the inner leaflet decreases. Reduction of the amount of PtdIns(4,5)P2 prevents the formation of the actin cortex and inhibits cross-linking activity of Ezrin, leading to the formation of larger bleb. Fragmented cellular components and substances such as DAMPs now can translocate to the bleb to form a functional apoptotic body.

Article Snippet: The following primary antibodies were used for immunoblotting: mouse anti-ROCK1 antibody mAb (Abcam), mouse anti–α-tubulin mAb (Sigma), and rabbit anti-Lamin A/C antibody pAb (Cell Signaling Technology). cDNAs encoding full-length human Rnd3, human Anillin C terminus, human Xkr8ΔC, human Lamin A, and human 14-3-3β were amplified by RT-PCR, fused to the sequence encoding enhanced GFP or FLAG tag, and ligated into the pCAGGS-neo vector. pEGFP-CytochromeC and pcDNA3-FlipGFP (Casp3 cleavage seq) T2A mCherry were obtained from Addgene (No. 41181 and No. 124428).

Techniques: Activation Assay, Clinical Proteomics, Membrane, Activity Assay, Functional Assay

Journal: Theranostics

Article Title: Exosomal STIMATE derived from type II alveolar epithelial cells controls metabolic reprogramming of tissue-resident alveolar macrophages

doi: 10.7150/thno.82552

Figure Lengend Snippet: STIMATE + ADE affects the SOCE-dependent Ca 2+ influx of TARMs. (A) Cocultivation model diagram of GFP-STIMATE mouse AEC-IIs with mouse TRAMs in a transwell plate. A 30 kDa semipermeable membrane ensures that exosomes smaller than 100 nm can pass through the pores. (B) Representative mouse AEC-IIs TIRF image of GFP-STIMATE + exosomes in the transwell top chamber after transfection with mtDNA after 24 h. (C) Representative CLSM of mouse TRAMs in the transwell bottom chamber after 12 h of cocultivation. The images from top to bottom sequentially show the merged GFP-STIMATE with anti-Sec61β (ERM marker), anti-STIM1, anti-Na + Ka + ATPase (PM marker) and anti-ORAI1. Scale bar: 2 μm. (D) The genetic background generated by STIMATE + -ADE, Inva.ADE and Insuff.ADE was secreted by GFP-tagged STIMATE WT AEC-IIs, STIMATE P. K241Q AEC-IIs and Rab27a KO mouse AEC-IIs. (E) Representative mouse AEC-IIs TIRF image of STIMATE + -ADE, Inva.ADE and Insuff.ADE after transfection with mtDNA after 24 h. Scale bar: 2 μm. (F) exosomes-based ELISA detects STIMATE + -ADE, Inva.ADE and Insuff.ADE released by GFP-tagged STIMATE WT AEC-IIs, STIMATE P. K241Q AEC-IIs and Rab27a KO mouse AEC-IIs after transfection with mtDNA after 24 h, respectively. Draw according to the reorganized STIMATE standard curve (n = 6). (G) Representative CLSM of mouse TRAMs in the transwell bottom chamber after 12 h of cocultivation with Inva.ADE and Insuff.ADE. The images from top to bottom sequentially show the merged GFP-STIMATE with anti-Sec61β, anti-STIM1, anti-Na + Ka + ATPase and anti-ORAI1. Scale bar: 2 μm. (H) Schematic diagram of the observations of SOCE based on STIM1-ORAI1 colocalized puncta in WT or STIMATE -/- mouse TRAMs after cocultivation with ADE. (I and J) Representative TIRF image of STIM1-GFP tag/ORAI1-mCherry tag cotransfected WT or STIMATE -/- mouse TRAMs stimulated with 1 μM TG for 8 min after cocultivation with STIMATE + -ADE, Inva.ADE and Insuff.ADE for 12 h, sequentially. The bar graph on the right shows the fluorescence density values of the fused fluorescent spots (n = 6). Scale bar, 2 μm. (K) Schematic diagram of the observations of Ca 2+ influx based on SOCE in WT or STIMATE -/- mouse TRAMs after cocultivation with ADE. (L) Ca 2+ influx in WT or STIMATE -/- mouse TRAMs preincubated with STIMATE + -ADE, Inva.ADE and Insuff.ADE before 1 μM TG induction. The figure shows the ratio of excitation wavelengths of Fura-2 AM at 340 nm and 380 nm. for n = 7-9 cells pooled across 3 independent experiments. Data are shown as the mean ± SD, *p < 0.05, and**p < 0.01 by analysis of variance (ANOVA) followed by a post hoc test compared to resting TRAMs. All data were derived from 3 independent experiments.

Article Snippet: Streptomycin affinity agarose-coated mtDNA beads were provided by Polysciences, biotin-labeled recombinant mouse SP-A was purchased from MedChemExpress, and biotin-labeled mCherry and GFP were purchased from Merck.

Techniques: Membrane, Transfection, Marker, Generated, Enzyme-linked Immunosorbent Assay, Fluorescence, Derivative Assay

Journal: Nature Communications

Article Title: Ethylene promotes SMAX1 accumulation to inhibit arbuscular mycorrhiza symbiosis

doi: 10.1038/s41467-025-57222-w

Figure Lengend Snippet: A Percent root length colonization (RLC) of L. japonicus wild type, smax1-2 and smax1-3 mutants co-cultured with R. irregularis (AMF) for 4 weeks. Individual data-points and mean ± SE are shown. N = 8. Different letters indicate statistical differences between genotypes. Welch and Brown-Forsythe one-way ANOVA with Holm-Sidak’s multiple comparisons test was performed [for total, F* (DFn, DFd) = 28.34 (2.000, 17.98) & W (DFn, DFd) = 25.48 (2.000, 13.03); for arbuscules, F* (DFn, DFd) = 16.03 (2.000, 20.95) & W (DFn, DFd) = 15.82 (2.000, 13.99); for vesicles, F* (DFn, DFd) = 43.31 (2.000, 17.58) & W (DFn, DFd) = 49.22 (2.000, 13.52)]. B Venn diagram showing the overlap of DEGs with increased expression in smax1-2 and smax1-3 roots in the absence of AMF with DEGs with reduced expression in ethephon-treated roots in the absence of AMF, and the AM genelist. Names of genes with genetically determined roles in AM symbiosis are shown. C Log 2 Fold-change heatmap for genes with genetically determined function in AM and displaying reduced expression after ethephon treatment or increased expression in the smax1 mutants. Genes written in bold belong to the 22 genes in the overlap of all three gene sets in ( B ). Numbers in cells represent significantly different (adjusted p -value ≤ 0.05) log 2 fold-change. Scale shows log 2 fold-change with blue indicating decrease and yellow indicating increase. Black cells represent non-significant change. To identify differentially expressed genes between groups, a two-sided exact test in edgeR, was used, accounting for both up- and downregulated genes. Adjusted p -values were calculated using the Benjamini-Hochberg procedure to control for multiple comparisons.

Article Snippet: The membrane was blocked in 5% skim milk powder (w/v) in PBS (pH 7.4) and probed for 90 minutes with the primary antibody rabbit anti-GFP to detect SMAX1 and SMAX1 D2 (ChromoTek, Martinsried, Germany, dilution: 1:5000) and rabbit anti-mCherry to detect mCherry (Thermo Fisher Scientific, USA, dilution: 1:5000) in 1% skim milk powder (w/v) dissolved in PBST (PBS, 0.2% Tween-20) at room temperature.

Techniques: Cell Culture, Expressing, Control

Journal: Nature Communications

Article Title: Ethylene promotes SMAX1 accumulation to inhibit arbuscular mycorrhiza symbiosis

doi: 10.1038/s41467-025-57222-w

Figure Lengend Snippet: A – C Percent root length colonization of indicated L. japonicus genotypes with R. irregularis (AMF) after indicated treatments at 4 wpi ( A , B ) or 5 wpi ( C ). D Log 2 Fold-change heatmap for indicated genes, genotypes and treatments. Numbers in cells represent significantly different (adjusted p -value ≤ 0.05) log 2 fold-change. Black cells represent non-significant change. E Confocal microscopy images of L. japonicus wild-type and ein2a ein2b hairy roots expressing p Ubi : SMAX1 D2 - GFP and a free p 35S:mCherry transformation marker from the same T-DNA and treated for 24 hours with solvent (water) or 1 µM ACC. Scale bars = 50 µm. F Ratios of mean intensities of nuclear GFP signal to nuclear mCherry signal measured in confocal microscopy images of hairy roots shown in E . G Percent root length colonization of L. japonicus wild type at 4 wpi with R. irregularis treated with solvent (0.0075% methanol for KAR 1 and water for ACC), karrikin 1 (KAR 1 ), ACC or a combination of both. Statistics: A Individual data-points and mean ± SE (N = 8) are shown. Two-way ANOVA [interaction F (2, 42) = 14.17 (P < 0.0001), treatment F (1, 42) = 0.4810 ( P = 0.4918), genotype F (2, 42) = 73.94 ( P < 0.0001)] with Tukey’s multiple comparisons test was used to assess significant differences between treatments and genotypes. B Individual data-points and mean ± SE (N = 8) are shown. Kruskal-Wallis test (Kruskal-Wallis H statistic = 19.56) with Dunn’s posthoc comparison assessed significant differences between genotypes and/or treatments. C Individual data points and mean ± SE are shown. N = 10; Kruskal-Wallis test [H statistic = 49.01] with Dunn’s posthoc comparison. F Individual data-points and mean ± SE (N = 111 for Solvent/WT, 107 for 1 μM ACC/WT, 177 for Solvent/ ein2a ein2b , 184 for 1 μM ACC/ ein2a ein2b ) are shown. Kruskal-Wallis test (Kruskal-Wallis H statistic = 115.0) with Dunn’s posthoc comparison assessed significant differences between genotypes and treatments. G Individual data-points and mean ± SE (N = 8) are shown. Kruskal-Wallis test (Kruskal-Wallis H statistic = 17.97 for total, 18.54 for arbuscules, 18.31 for vesicles) with Dunn’s posthoc comparison was used to assess significant differences between treatments for each indicated AMF structure. A – C , F – G Different letters indicate statistical differences.

Article Snippet: The membrane was blocked in 5% skim milk powder (w/v) in PBS (pH 7.4) and probed for 90 minutes with the primary antibody rabbit anti-GFP to detect SMAX1 and SMAX1 D2 (ChromoTek, Martinsried, Germany, dilution: 1:5000) and rabbit anti-mCherry to detect mCherry (Thermo Fisher Scientific, USA, dilution: 1:5000) in 1% skim milk powder (w/v) dissolved in PBST (PBS, 0.2% Tween-20) at room temperature.

Techniques: Confocal Microscopy, Expressing, Transformation Assay, Marker, Solvent, Comparison

Journal: Nature Communications

Article Title: Ethylene promotes SMAX1 accumulation to inhibit arbuscular mycorrhiza symbiosis

doi: 10.1038/s41467-025-57222-w

Figure Lengend Snippet: A Upon perception of KAI2-ligand, KAI2 forms a complex with the SCF complex through the F-box protein MAX2 to ubiquitylate SMAX1 leading to its proteasomal degradation. This releases AM-relevant strigolactone biosynthesis genes (e.g., CCD7 , CCD8 ), LysM receptors and common symbiosis genes ( LYS7 , CCaMK , CYCLOPS , DELLA ), DELLA INTERACTING PROTEIN 1 ( DIP1) and other (AM-relevant) genes (not shown), from suppression allowing efficient AM development (this work). Ethylene via EIN2 or via the product of ethylene-responsive genes (dashed arrows indicate hypothetical connections) promotes accumulation of SMAX1 and, therefore, suppression of the AM-relevant genes leading to suppression of AM. SMAX1 also acts as a negative regulator of an ethylene biosynthesis gene . Thus, SMAX1 degradation leads to increased ethylene biosynthesis, again causing accumulation of SMAX1 . This negative feedback loop may allow fine-tuning of root colonization by AMF in accordance with the stress level of the plant. B At low levels of ethylene and phosphate starvation plants strongly express strigolactone biosynthesis genes, Myc factor receptor genes (LysM RLKs) as well as common symbiosis genes to stimulate the fungus with exuded strigolactone and to accommodate the fungus inside roots. At high levels of ethylene SMAX1 accumulates, leading to repression of strigolactone biosynthesis, Myc factor receptor and Common Symbiosis genes and as a consequence poor stimulation and intraradical accommodation of the fungus.

Article Snippet: The membrane was blocked in 5% skim milk powder (w/v) in PBS (pH 7.4) and probed for 90 minutes with the primary antibody rabbit anti-GFP to detect SMAX1 and SMAX1 D2 (ChromoTek, Martinsried, Germany, dilution: 1:5000) and rabbit anti-mCherry to detect mCherry (Thermo Fisher Scientific, USA, dilution: 1:5000) in 1% skim milk powder (w/v) dissolved in PBST (PBS, 0.2% Tween-20) at room temperature.

Techniques:

Journal: bioRxiv

Article Title: Optogenetic activators of apoptosis, necroptosis and pyroptosis for probing cell death dynamics and bystander cell responses

doi: 10.1101/2021.08.31.458313

Figure Lengend Snippet: A, Schematic representation of the inflammasome pathway and Cry2-mediated clustering of inflammatory caspases. B, Domain architecture of native human inflammatory caspases. C, Design of optoCaspase constructs. D, Quantification of CellTox-positive (permeabilized) GSDMD-transgenic (GSDMD tg ) HEK293T cells expressing different optoCaspases at indicated timepoints following illumination with blue light (488nm, 5 mW/cm 2 ) every 30 sec. Here and after, only cells expressing the constructs at detectable levels (mCherry + ) at t=0 were quantified. E, Representative time-lapse images of GSDMD tg HEK293T cells subjected to light-induced activation of Cry2olig or optoCaspase-1, −4 or −5 in presence of Annexin V (to visualize PS exposure) and CellTox Green (membrane permeabilization marker). Scale bar, 20 µ m. F, GSDMD tg HEK293T cells expressing indicated constructs were imaged for 10 min in absence of blue light stimulation, and then illuminated as described in 1D for additional 30 min. The percentage of pyroptotic cells was determined at 1 min intervals by quantifying DRAQ7 (far-red membrane-impermeable DNA-binding dye)-positive nuclei. G-H, Percentage of CellTox + GSDMD tg HEK23T cells expressing wild-type or mutant optoCaspases or treated with the pan-caspase inhibitor Z-VAD-fmk before and after illumination. I, Percentage of CellTox + cells in different cell lines expressing indicated constructs at 1 h post illumination. All data are shown as mean ± s.d. (D, G-I) or mean ± s.e.m. (F) and are representative of (E) or pooled from (D, F, G, H, I) three independent experiments. **** P < 0.0001, ** p < 0.01 (two-tailed t-test).

Article Snippet: Amplified fragments were fused C- or N-terminally to Cry2olig (as indicated in the text and figures) using overlap-extension PCR and subcloned into NheI/BstBI cloning sites of pLJM1 (Addgene plasmid 19319) for constitutive expression or EcoRI site of pLVX (TaKaRa, Cat. No. 632164) for doxycycline-inducible expression using InFusion HD cloning kit (TaKaRa).

Techniques: Construct, CellTox Assay, Transgenic Assay, Expressing, Activation Assay, Membrane, Marker, Binding Assay, Mutagenesis, Two Tailed Test

Journal: bioRxiv

Article Title: Optogenetic activators of apoptosis, necroptosis and pyroptosis for probing cell death dynamics and bystander cell responses

doi: 10.1101/2021.08.31.458313

Figure Lengend Snippet: A-B, Representative images and quantification of CellTox + PMA-differentiated U937 cells expressing the indicated constructs before and after 1h of blue light stimulation (5 mW/cm 2 every 30 sec). C, E, Release of LDH and IL-1β from U937 cells expressing the indicated constructs and treated with nigericin (C), transfected with LPS (E) or illuminated with blue light (4 mW/cm 2 ) for the indicated time points. Non-transduced wild-type U937 were used as a control. NT, non-treated. D, F, immunoblot analysis of the combined cell lysates and supernatants obtained from C or E, respectively. Anti-mCherry antibodies were used to visualize full-length and processed optoCaspase-1/-4/-5 and Cry2olig. A, C-F are representative of at least 3 independent experiments, B is pooled from 3 experiments. Mean ± s.d., **** P < 0.0001, n.s. – non-significant (one-way ANOVA).

Article Snippet: Amplified fragments were fused C- or N-terminally to Cry2olig (as indicated in the text and figures) using overlap-extension PCR and subcloned into NheI/BstBI cloning sites of pLJM1 (Addgene plasmid 19319) for constitutive expression or EcoRI site of pLVX (TaKaRa, Cat. No. 632164) for doxycycline-inducible expression using InFusion HD cloning kit (TaKaRa).

Techniques: CellTox Assay, Expressing, Construct, Transfection, Control, Western Blot

Journal: bioRxiv

Article Title: Optogenetic activators of apoptosis, necroptosis and pyroptosis for probing cell death dynamics and bystander cell responses

doi: 10.1101/2021.08.31.458313

Figure Lengend Snippet: A , Design of Opto-caspase construct for heat-shock-induced expression of mCherry-Cry2olig fusion with zfCaspa, zfCaspb or zfCaspase-8. Numbers depict the boundaries between different domains. Depicted are also the Tol2 site flanking the Opto-caspase cassette and the heart specific promoter cmlc2 driving tagRFP expression. B , Experimental setup for expression, activation and imaging of optogenetic induction of PCD. Grey shaded is the time frame in which panel C was acquired. C , Time-lapse imaging of 2,5-dpf Tg(Opto-caspa)Xasc:asc-gfp larvae after heat shock. Shown are time points corresponding to the time directly after heatshock, and 6 and 12 hphs. Scale bar 500 µ m. D , Schematic depiction of a zebrafish larvae showing location of keratinocytes, basal cells and muscle cells. E-G Opto-caspase lines were crossed to tg(Krt4:AKT-PH-GFP)(green). Opto-caspase construct expression in red. Time scale is in hours, starting at the first timepoint of 488 laser exposure. Fluorescent images are z-projections, bright field images are single planes. Dying cells are outlined by dashed lines. Scale bar for all images are 20 µ m. E . Representative time lapse images of keratinocyte pyroptosis and muscle cell death after activation of Opto-zfCaspa and single plane bright field image. F . Representative time lapse images of keratinocyte, basal cell and muscle cells dying after activation of Opto-zfCasp8. G , Representative time lapse images of keratinocyte, after activation of Opto-zfCaspb. H , Two photon-activation of Opto-zfCaspa (red) in single cells. Illumination frame is highlighted in grey. Opto-zfCaspa was crossed to asc:asc-gfp line, asc-gfp (green) is visible only in 2-Photon illuminated squares. The starting frame is right before 2-Photon activation. Scale bar is 20 µ m.

Article Snippet: Amplified fragments were fused C- or N-terminally to Cry2olig (as indicated in the text and figures) using overlap-extension PCR and subcloned into NheI/BstBI cloning sites of pLJM1 (Addgene plasmid 19319) for constitutive expression or EcoRI site of pLVX (TaKaRa, Cat. No. 632164) for doxycycline-inducible expression using InFusion HD cloning kit (TaKaRa).

Techniques: Construct, Expressing, Activation Assay, Imaging

Journal: The Journal of Cell Biology

Article Title: The role of APC-mediated actin assembly in microtubule capture and focal adhesion turnover

doi: 10.1083/jcb.201904165

Figure Lengend Snippet: Key resources

Article Snippet: To monitor autophagosome fusion with autolysosomes (Fig. S5 D), MDA-MB-231 cells were transfected as described in collagen-coated glass-bottom dishes with three different plasmids: 500 ng of a plasmid expressing GFP-LC3 (autophagosomes marker), 500 ng of a plasmid expressing mCherry-LAMP1 (lysosomal-associated membrane protein 1, a lysosome/late endosome marker; 61524; Addgene), and 600 ng of a plasmid expressing full-length APC (WT or m4).

Techniques: Virus, Recombinant, Sequencing, Plasmid Preparation, Software, Fluorescence, Imaging